Review



ant gn 1 fugene promega  (InvivoGen)


Bioz Verified Symbol InvivoGen is a verified supplier
Bioz Manufacturer Symbol InvivoGen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    InvivoGen ant gn 1 fugene promega
    Ant Gn 1 Fugene Promega, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1450 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ant+gn+1+fugene+promega/G418/pm42019505-253-152-150
    Average 99 stars, based on 1450 article reviews
    ant gn 1 fugene promega - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Microtubule organization and molecular architecture of ciliary basal bodies in multiciliated airway cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 594 Donkey anti-rabbit IgG (H+L) Thermo Fisher Cat# A-11037; RRID: AB_2534095 Abberior STAR 635P Donkey anti-mouse IgG (H+L) Abberior STAR Cat# ST635P; RRID: AB_2893232 Atto Fluor 647N Donkey anti-rabbit IgG (H+L) Sigma Aldrich Cat# 40839 Alexa Fluor 488 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11006; RRID: AB_2534074 Alexa Fluor 594 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11007 RRID: AB_10561522 IRDye 680LT Donkey anti-rabbit IgG Li-Cor Biosciences Cat# 926-68023; RRID: AB_10706167 HRP Goat anti-mouse IgG Agilent Cat# P044701-2; RRID: AB_2617137 Chemicals, peptides, and recombinant proteins Atto-NHS-594 ATTO_TEC Cat# 594-31 Atto-NHS-643 ATTO-TEC Cat# 643-35 Atto-NHS-647N Sigma Aldrich Cat# 07376 Rspo3-Fc Fusion Protein Conditioned Medium IPA Cat# R001 Acryloyl X-SE Thermo Fisher Cat# A-20770 ProLongTM Diamont Antifade Mountant Thermo Fischer Cat# P36961 PhosSTOP Phosphatase Inhibitor Cocktail Roche Cat# 4906845001 cOmplete Protease Inhibitor Cocktail Roche Cat# 4693116001 Polybrene Infection Reagent Millipore Cat# TR-1003 G418 Geneticin InvivoGen Cat# ant-gn-1 FuGENE Promega Cat# E2691 Doxycycline Abcam Cat# ab141091 Nocodazole Sigma Aldrich Cat# M1404 Vectashield Vector Laboratories Cat# H-1000 Critical commercial assays ECL Western blotting detection kit BioRad Cat# 1705061 Deposited data Raw and analyzed data This paper DOI: 10.24416/UU01-R1MHVT Source code for the averaging analysis This paper DOI: 10.5281/zenodo.16572146 Experimental models: Cell lines Human Nasal Epithelial Cells 3 UMC Utrecht Tcbio ID 22-079 Human Nasal Epithelial Cells 4 UMC Utrecht Tcbio ID 22-079 RPE-1 cells ATCC CRL-4000 Oligonucleotides gRNA1 ninein: GCTCAGCCCAAATATGTTAG This paper N/A gRNA2 ninein: CGAGTTCCAAGAGTCCGTGG This paper N/A gRNA3 ninein: GGCCGCGTTCTTCATCCAG This paper N/A gRNA4 ninein: GGCCGCGCTTCTTCATCCAG This paper N/A shRNA NEDD1: GCAGACATGTGTCAATTTA Schweizer et al.65 N/A shRNA HAUS6: CAGTTAAGCAGGTACGAA Schweizer et al.65 N/A pMD2.9 Addgene Addgene_12260 psPAX2 Addgene Addgene_12259 Px459 Addgene Addgene_62988 Software and algorithms Python Python https://www.python.org FIJI ImageJ https://fiji.sc Huygens Professional software v. 17.04 Huygens Professional Scientific Volume Imaging, Hilversum, The Netherlands Arivis Vision4D v.3.5 Arrivis Arivis AG, Carl Zeiss Microscopy GmbH, Munich, Germany (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–19.e1–e8, May 4, 2026 e2 Article ..

    Indirect Immunoperoxidase Assay:

    Article Title: Microtubule organization and molecular architecture of ciliary basal bodies in multiciliated airway cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 594 Donkey anti-rabbit IgG (H+L) Thermo Fisher Cat# A-11037; RRID: AB_2534095 Abberior STAR 635P Donkey anti-mouse IgG (H+L) Abberior STAR Cat# ST635P; RRID: AB_2893232 Atto Fluor 647N Donkey anti-rabbit IgG (H+L) Sigma Aldrich Cat# 40839 Alexa Fluor 488 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11006; RRID: AB_2534074 Alexa Fluor 594 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11007 RRID: AB_10561522 IRDye 680LT Donkey anti-rabbit IgG Li-Cor Biosciences Cat# 926-68023; RRID: AB_10706167 HRP Goat anti-mouse IgG Agilent Cat# P044701-2; RRID: AB_2617137 Chemicals, peptides, and recombinant proteins Atto-NHS-594 ATTO_TEC Cat# 594-31 Atto-NHS-643 ATTO-TEC Cat# 643-35 Atto-NHS-647N Sigma Aldrich Cat# 07376 Rspo3-Fc Fusion Protein Conditioned Medium IPA Cat# R001 Acryloyl X-SE Thermo Fisher Cat# A-20770 ProLongTM Diamont Antifade Mountant Thermo Fischer Cat# P36961 PhosSTOP Phosphatase Inhibitor Cocktail Roche Cat# 4906845001 cOmplete Protease Inhibitor Cocktail Roche Cat# 4693116001 Polybrene Infection Reagent Millipore Cat# TR-1003 G418 Geneticin InvivoGen Cat# ant-gn-1 FuGENE Promega Cat# E2691 Doxycycline Abcam Cat# ab141091 Nocodazole Sigma Aldrich Cat# M1404 Vectashield Vector Laboratories Cat# H-1000 Critical commercial assays ECL Western blotting detection kit BioRad Cat# 1705061 Deposited data Raw and analyzed data This paper DOI: 10.24416/UU01-R1MHVT Source code for the averaging analysis This paper DOI: 10.5281/zenodo.16572146 Experimental models: Cell lines Human Nasal Epithelial Cells 3 UMC Utrecht Tcbio ID 22-079 Human Nasal Epithelial Cells 4 UMC Utrecht Tcbio ID 22-079 RPE-1 cells ATCC CRL-4000 Oligonucleotides gRNA1 ninein: GCTCAGCCCAAATATGTTAG This paper N/A gRNA2 ninein: CGAGTTCCAAGAGTCCGTGG This paper N/A gRNA3 ninein: GGCCGCGTTCTTCATCCAG This paper N/A gRNA4 ninein: GGCCGCGCTTCTTCATCCAG This paper N/A shRNA NEDD1: GCAGACATGTGTCAATTTA Schweizer et al.65 N/A shRNA HAUS6: CAGTTAAGCAGGTACGAA Schweizer et al.65 N/A pMD2.9 Addgene Addgene_12260 psPAX2 Addgene Addgene_12259 Px459 Addgene Addgene_62988 Software and algorithms Python Python https://www.python.org FIJI ImageJ https://fiji.sc Huygens Professional software v. 17.04 Huygens Professional Scientific Volume Imaging, Hilversum, The Netherlands Arivis Vision4D v.3.5 Arrivis Arivis AG, Carl Zeiss Microscopy GmbH, Munich, Germany (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–19.e1–e8, May 4, 2026 e2 Article ..

    Protease Inhibitor:

    Article Title: Microtubule organization and molecular architecture of ciliary basal bodies in multiciliated airway cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 594 Donkey anti-rabbit IgG (H+L) Thermo Fisher Cat# A-11037; RRID: AB_2534095 Abberior STAR 635P Donkey anti-mouse IgG (H+L) Abberior STAR Cat# ST635P; RRID: AB_2893232 Atto Fluor 647N Donkey anti-rabbit IgG (H+L) Sigma Aldrich Cat# 40839 Alexa Fluor 488 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11006; RRID: AB_2534074 Alexa Fluor 594 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11007 RRID: AB_10561522 IRDye 680LT Donkey anti-rabbit IgG Li-Cor Biosciences Cat# 926-68023; RRID: AB_10706167 HRP Goat anti-mouse IgG Agilent Cat# P044701-2; RRID: AB_2617137 Chemicals, peptides, and recombinant proteins Atto-NHS-594 ATTO_TEC Cat# 594-31 Atto-NHS-643 ATTO-TEC Cat# 643-35 Atto-NHS-647N Sigma Aldrich Cat# 07376 Rspo3-Fc Fusion Protein Conditioned Medium IPA Cat# R001 Acryloyl X-SE Thermo Fisher Cat# A-20770 ProLongTM Diamont Antifade Mountant Thermo Fischer Cat# P36961 PhosSTOP Phosphatase Inhibitor Cocktail Roche Cat# 4906845001 cOmplete Protease Inhibitor Cocktail Roche Cat# 4693116001 Polybrene Infection Reagent Millipore Cat# TR-1003 G418 Geneticin InvivoGen Cat# ant-gn-1 FuGENE Promega Cat# E2691 Doxycycline Abcam Cat# ab141091 Nocodazole Sigma Aldrich Cat# M1404 Vectashield Vector Laboratories Cat# H-1000 Critical commercial assays ECL Western blotting detection kit BioRad Cat# 1705061 Deposited data Raw and analyzed data This paper DOI: 10.24416/UU01-R1MHVT Source code for the averaging analysis This paper DOI: 10.5281/zenodo.16572146 Experimental models: Cell lines Human Nasal Epithelial Cells 3 UMC Utrecht Tcbio ID 22-079 Human Nasal Epithelial Cells 4 UMC Utrecht Tcbio ID 22-079 RPE-1 cells ATCC CRL-4000 Oligonucleotides gRNA1 ninein: GCTCAGCCCAAATATGTTAG This paper N/A gRNA2 ninein: CGAGTTCCAAGAGTCCGTGG This paper N/A gRNA3 ninein: GGCCGCGTTCTTCATCCAG This paper N/A gRNA4 ninein: GGCCGCGCTTCTTCATCCAG This paper N/A shRNA NEDD1: GCAGACATGTGTCAATTTA Schweizer et al.65 N/A shRNA HAUS6: CAGTTAAGCAGGTACGAA Schweizer et al.65 N/A pMD2.9 Addgene Addgene_12260 psPAX2 Addgene Addgene_12259 Px459 Addgene Addgene_62988 Software and algorithms Python Python https://www.python.org FIJI ImageJ https://fiji.sc Huygens Professional software v. 17.04 Huygens Professional Scientific Volume Imaging, Hilversum, The Netherlands Arivis Vision4D v.3.5 Arrivis Arivis AG, Carl Zeiss Microscopy GmbH, Munich, Germany (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–19.e1–e8, May 4, 2026 e2 Article ..

    Infection:

    Article Title: Microtubule organization and molecular architecture of ciliary basal bodies in multiciliated airway cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 594 Donkey anti-rabbit IgG (H+L) Thermo Fisher Cat# A-11037; RRID: AB_2534095 Abberior STAR 635P Donkey anti-mouse IgG (H+L) Abberior STAR Cat# ST635P; RRID: AB_2893232 Atto Fluor 647N Donkey anti-rabbit IgG (H+L) Sigma Aldrich Cat# 40839 Alexa Fluor 488 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11006; RRID: AB_2534074 Alexa Fluor 594 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11007 RRID: AB_10561522 IRDye 680LT Donkey anti-rabbit IgG Li-Cor Biosciences Cat# 926-68023; RRID: AB_10706167 HRP Goat anti-mouse IgG Agilent Cat# P044701-2; RRID: AB_2617137 Chemicals, peptides, and recombinant proteins Atto-NHS-594 ATTO_TEC Cat# 594-31 Atto-NHS-643 ATTO-TEC Cat# 643-35 Atto-NHS-647N Sigma Aldrich Cat# 07376 Rspo3-Fc Fusion Protein Conditioned Medium IPA Cat# R001 Acryloyl X-SE Thermo Fisher Cat# A-20770 ProLongTM Diamont Antifade Mountant Thermo Fischer Cat# P36961 PhosSTOP Phosphatase Inhibitor Cocktail Roche Cat# 4906845001 cOmplete Protease Inhibitor Cocktail Roche Cat# 4693116001 Polybrene Infection Reagent Millipore Cat# TR-1003 G418 Geneticin InvivoGen Cat# ant-gn-1 FuGENE Promega Cat# E2691 Doxycycline Abcam Cat# ab141091 Nocodazole Sigma Aldrich Cat# M1404 Vectashield Vector Laboratories Cat# H-1000 Critical commercial assays ECL Western blotting detection kit BioRad Cat# 1705061 Deposited data Raw and analyzed data This paper DOI: 10.24416/UU01-R1MHVT Source code for the averaging analysis This paper DOI: 10.5281/zenodo.16572146 Experimental models: Cell lines Human Nasal Epithelial Cells 3 UMC Utrecht Tcbio ID 22-079 Human Nasal Epithelial Cells 4 UMC Utrecht Tcbio ID 22-079 RPE-1 cells ATCC CRL-4000 Oligonucleotides gRNA1 ninein: GCTCAGCCCAAATATGTTAG This paper N/A gRNA2 ninein: CGAGTTCCAAGAGTCCGTGG This paper N/A gRNA3 ninein: GGCCGCGTTCTTCATCCAG This paper N/A gRNA4 ninein: GGCCGCGCTTCTTCATCCAG This paper N/A shRNA NEDD1: GCAGACATGTGTCAATTTA Schweizer et al.65 N/A shRNA HAUS6: CAGTTAAGCAGGTACGAA Schweizer et al.65 N/A pMD2.9 Addgene Addgene_12260 psPAX2 Addgene Addgene_12259 Px459 Addgene Addgene_62988 Software and algorithms Python Python https://www.python.org FIJI ImageJ https://fiji.sc Huygens Professional software v. 17.04 Huygens Professional Scientific Volume Imaging, Hilversum, The Netherlands Arivis Vision4D v.3.5 Arrivis Arivis AG, Carl Zeiss Microscopy GmbH, Munich, Germany (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–19.e1–e8, May 4, 2026 e2 Article ..

    Western Blot:

    Article Title: Microtubule organization and molecular architecture of ciliary basal bodies in multiciliated airway cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 594 Donkey anti-rabbit IgG (H+L) Thermo Fisher Cat# A-11037; RRID: AB_2534095 Abberior STAR 635P Donkey anti-mouse IgG (H+L) Abberior STAR Cat# ST635P; RRID: AB_2893232 Atto Fluor 647N Donkey anti-rabbit IgG (H+L) Sigma Aldrich Cat# 40839 Alexa Fluor 488 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11006; RRID: AB_2534074 Alexa Fluor 594 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11007 RRID: AB_10561522 IRDye 680LT Donkey anti-rabbit IgG Li-Cor Biosciences Cat# 926-68023; RRID: AB_10706167 HRP Goat anti-mouse IgG Agilent Cat# P044701-2; RRID: AB_2617137 Chemicals, peptides, and recombinant proteins Atto-NHS-594 ATTO_TEC Cat# 594-31 Atto-NHS-643 ATTO-TEC Cat# 643-35 Atto-NHS-647N Sigma Aldrich Cat# 07376 Rspo3-Fc Fusion Protein Conditioned Medium IPA Cat# R001 Acryloyl X-SE Thermo Fisher Cat# A-20770 ProLongTM Diamont Antifade Mountant Thermo Fischer Cat# P36961 PhosSTOP Phosphatase Inhibitor Cocktail Roche Cat# 4906845001 cOmplete Protease Inhibitor Cocktail Roche Cat# 4693116001 Polybrene Infection Reagent Millipore Cat# TR-1003 G418 Geneticin InvivoGen Cat# ant-gn-1 FuGENE Promega Cat# E2691 Doxycycline Abcam Cat# ab141091 Nocodazole Sigma Aldrich Cat# M1404 Vectashield Vector Laboratories Cat# H-1000 Critical commercial assays ECL Western blotting detection kit BioRad Cat# 1705061 Deposited data Raw and analyzed data This paper DOI: 10.24416/UU01-R1MHVT Source code for the averaging analysis This paper DOI: 10.5281/zenodo.16572146 Experimental models: Cell lines Human Nasal Epithelial Cells 3 UMC Utrecht Tcbio ID 22-079 Human Nasal Epithelial Cells 4 UMC Utrecht Tcbio ID 22-079 RPE-1 cells ATCC CRL-4000 Oligonucleotides gRNA1 ninein: GCTCAGCCCAAATATGTTAG This paper N/A gRNA2 ninein: CGAGTTCCAAGAGTCCGTGG This paper N/A gRNA3 ninein: GGCCGCGTTCTTCATCCAG This paper N/A gRNA4 ninein: GGCCGCGCTTCTTCATCCAG This paper N/A shRNA NEDD1: GCAGACATGTGTCAATTTA Schweizer et al.65 N/A shRNA HAUS6: CAGTTAAGCAGGTACGAA Schweizer et al.65 N/A pMD2.9 Addgene Addgene_12260 psPAX2 Addgene Addgene_12259 Px459 Addgene Addgene_62988 Software and algorithms Python Python https://www.python.org FIJI ImageJ https://fiji.sc Huygens Professional software v. 17.04 Huygens Professional Scientific Volume Imaging, Hilversum, The Netherlands Arivis Vision4D v.3.5 Arrivis Arivis AG, Carl Zeiss Microscopy GmbH, Munich, Germany (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–19.e1–e8, May 4, 2026 e2 Article ..

    shRNA:

    Article Title: Microtubule organization and molecular architecture of ciliary basal bodies in multiciliated airway cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 594 Donkey anti-rabbit IgG (H+L) Thermo Fisher Cat# A-11037; RRID: AB_2534095 Abberior STAR 635P Donkey anti-mouse IgG (H+L) Abberior STAR Cat# ST635P; RRID: AB_2893232 Atto Fluor 647N Donkey anti-rabbit IgG (H+L) Sigma Aldrich Cat# 40839 Alexa Fluor 488 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11006; RRID: AB_2534074 Alexa Fluor 594 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11007 RRID: AB_10561522 IRDye 680LT Donkey anti-rabbit IgG Li-Cor Biosciences Cat# 926-68023; RRID: AB_10706167 HRP Goat anti-mouse IgG Agilent Cat# P044701-2; RRID: AB_2617137 Chemicals, peptides, and recombinant proteins Atto-NHS-594 ATTO_TEC Cat# 594-31 Atto-NHS-643 ATTO-TEC Cat# 643-35 Atto-NHS-647N Sigma Aldrich Cat# 07376 Rspo3-Fc Fusion Protein Conditioned Medium IPA Cat# R001 Acryloyl X-SE Thermo Fisher Cat# A-20770 ProLongTM Diamont Antifade Mountant Thermo Fischer Cat# P36961 PhosSTOP Phosphatase Inhibitor Cocktail Roche Cat# 4906845001 cOmplete Protease Inhibitor Cocktail Roche Cat# 4693116001 Polybrene Infection Reagent Millipore Cat# TR-1003 G418 Geneticin InvivoGen Cat# ant-gn-1 FuGENE Promega Cat# E2691 Doxycycline Abcam Cat# ab141091 Nocodazole Sigma Aldrich Cat# M1404 Vectashield Vector Laboratories Cat# H-1000 Critical commercial assays ECL Western blotting detection kit BioRad Cat# 1705061 Deposited data Raw and analyzed data This paper DOI: 10.24416/UU01-R1MHVT Source code for the averaging analysis This paper DOI: 10.5281/zenodo.16572146 Experimental models: Cell lines Human Nasal Epithelial Cells 3 UMC Utrecht Tcbio ID 22-079 Human Nasal Epithelial Cells 4 UMC Utrecht Tcbio ID 22-079 RPE-1 cells ATCC CRL-4000 Oligonucleotides gRNA1 ninein: GCTCAGCCCAAATATGTTAG This paper N/A gRNA2 ninein: CGAGTTCCAAGAGTCCGTGG This paper N/A gRNA3 ninein: GGCCGCGTTCTTCATCCAG This paper N/A gRNA4 ninein: GGCCGCGCTTCTTCATCCAG This paper N/A shRNA NEDD1: GCAGACATGTGTCAATTTA Schweizer et al.65 N/A shRNA HAUS6: CAGTTAAGCAGGTACGAA Schweizer et al.65 N/A pMD2.9 Addgene Addgene_12260 psPAX2 Addgene Addgene_12259 Px459 Addgene Addgene_62988 Software and algorithms Python Python https://www.python.org FIJI ImageJ https://fiji.sc Huygens Professional software v. 17.04 Huygens Professional Scientific Volume Imaging, Hilversum, The Netherlands Arivis Vision4D v.3.5 Arrivis Arivis AG, Carl Zeiss Microscopy GmbH, Munich, Germany (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–19.e1–e8, May 4, 2026 e2 Article ..

    Software:

    Article Title: Microtubule organization and molecular architecture of ciliary basal bodies in multiciliated airway cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 594 Donkey anti-rabbit IgG (H+L) Thermo Fisher Cat# A-11037; RRID: AB_2534095 Abberior STAR 635P Donkey anti-mouse IgG (H+L) Abberior STAR Cat# ST635P; RRID: AB_2893232 Atto Fluor 647N Donkey anti-rabbit IgG (H+L) Sigma Aldrich Cat# 40839 Alexa Fluor 488 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11006; RRID: AB_2534074 Alexa Fluor 594 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11007 RRID: AB_10561522 IRDye 680LT Donkey anti-rabbit IgG Li-Cor Biosciences Cat# 926-68023; RRID: AB_10706167 HRP Goat anti-mouse IgG Agilent Cat# P044701-2; RRID: AB_2617137 Chemicals, peptides, and recombinant proteins Atto-NHS-594 ATTO_TEC Cat# 594-31 Atto-NHS-643 ATTO-TEC Cat# 643-35 Atto-NHS-647N Sigma Aldrich Cat# 07376 Rspo3-Fc Fusion Protein Conditioned Medium IPA Cat# R001 Acryloyl X-SE Thermo Fisher Cat# A-20770 ProLongTM Diamont Antifade Mountant Thermo Fischer Cat# P36961 PhosSTOP Phosphatase Inhibitor Cocktail Roche Cat# 4906845001 cOmplete Protease Inhibitor Cocktail Roche Cat# 4693116001 Polybrene Infection Reagent Millipore Cat# TR-1003 G418 Geneticin InvivoGen Cat# ant-gn-1 FuGENE Promega Cat# E2691 Doxycycline Abcam Cat# ab141091 Nocodazole Sigma Aldrich Cat# M1404 Vectashield Vector Laboratories Cat# H-1000 Critical commercial assays ECL Western blotting detection kit BioRad Cat# 1705061 Deposited data Raw and analyzed data This paper DOI: 10.24416/UU01-R1MHVT Source code for the averaging analysis This paper DOI: 10.5281/zenodo.16572146 Experimental models: Cell lines Human Nasal Epithelial Cells 3 UMC Utrecht Tcbio ID 22-079 Human Nasal Epithelial Cells 4 UMC Utrecht Tcbio ID 22-079 RPE-1 cells ATCC CRL-4000 Oligonucleotides gRNA1 ninein: GCTCAGCCCAAATATGTTAG This paper N/A gRNA2 ninein: CGAGTTCCAAGAGTCCGTGG This paper N/A gRNA3 ninein: GGCCGCGTTCTTCATCCAG This paper N/A gRNA4 ninein: GGCCGCGCTTCTTCATCCAG This paper N/A shRNA NEDD1: GCAGACATGTGTCAATTTA Schweizer et al.65 N/A shRNA HAUS6: CAGTTAAGCAGGTACGAA Schweizer et al.65 N/A pMD2.9 Addgene Addgene_12260 psPAX2 Addgene Addgene_12259 Px459 Addgene Addgene_62988 Software and algorithms Python Python https://www.python.org FIJI ImageJ https://fiji.sc Huygens Professional software v. 17.04 Huygens Professional Scientific Volume Imaging, Hilversum, The Netherlands Arivis Vision4D v.3.5 Arrivis Arivis AG, Carl Zeiss Microscopy GmbH, Munich, Germany (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–19.e1–e8, May 4, 2026 e2 Article ..

    Imaging:

    Article Title: Microtubule organization and molecular architecture of ciliary basal bodies in multiciliated airway cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 594 Donkey anti-rabbit IgG (H+L) Thermo Fisher Cat# A-11037; RRID: AB_2534095 Abberior STAR 635P Donkey anti-mouse IgG (H+L) Abberior STAR Cat# ST635P; RRID: AB_2893232 Atto Fluor 647N Donkey anti-rabbit IgG (H+L) Sigma Aldrich Cat# 40839 Alexa Fluor 488 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11006; RRID: AB_2534074 Alexa Fluor 594 Donkey anti-rat IgG (H+L) Life technologies Cat# A-11007 RRID: AB_10561522 IRDye 680LT Donkey anti-rabbit IgG Li-Cor Biosciences Cat# 926-68023; RRID: AB_10706167 HRP Goat anti-mouse IgG Agilent Cat# P044701-2; RRID: AB_2617137 Chemicals, peptides, and recombinant proteins Atto-NHS-594 ATTO_TEC Cat# 594-31 Atto-NHS-643 ATTO-TEC Cat# 643-35 Atto-NHS-647N Sigma Aldrich Cat# 07376 Rspo3-Fc Fusion Protein Conditioned Medium IPA Cat# R001 Acryloyl X-SE Thermo Fisher Cat# A-20770 ProLongTM Diamont Antifade Mountant Thermo Fischer Cat# P36961 PhosSTOP Phosphatase Inhibitor Cocktail Roche Cat# 4906845001 cOmplete Protease Inhibitor Cocktail Roche Cat# 4693116001 Polybrene Infection Reagent Millipore Cat# TR-1003 G418 Geneticin InvivoGen Cat# ant-gn-1 FuGENE Promega Cat# E2691 Doxycycline Abcam Cat# ab141091 Nocodazole Sigma Aldrich Cat# M1404 Vectashield Vector Laboratories Cat# H-1000 Critical commercial assays ECL Western blotting detection kit BioRad Cat# 1705061 Deposited data Raw and analyzed data This paper DOI: 10.24416/UU01-R1MHVT Source code for the averaging analysis This paper DOI: 10.5281/zenodo.16572146 Experimental models: Cell lines Human Nasal Epithelial Cells 3 UMC Utrecht Tcbio ID 22-079 Human Nasal Epithelial Cells 4 UMC Utrecht Tcbio ID 22-079 RPE-1 cells ATCC CRL-4000 Oligonucleotides gRNA1 ninein: GCTCAGCCCAAATATGTTAG This paper N/A gRNA2 ninein: CGAGTTCCAAGAGTCCGTGG This paper N/A gRNA3 ninein: GGCCGCGTTCTTCATCCAG This paper N/A gRNA4 ninein: GGCCGCGCTTCTTCATCCAG This paper N/A shRNA NEDD1: GCAGACATGTGTCAATTTA Schweizer et al.65 N/A shRNA HAUS6: CAGTTAAGCAGGTACGAA Schweizer et al.65 N/A pMD2.9 Addgene Addgene_12260 psPAX2 Addgene Addgene_12259 Px459 Addgene Addgene_62988 Software and algorithms Python Python https://www.python.org FIJI ImageJ https://fiji.sc Huygens Professional software v. 17.04 Huygens Professional Scientific Volume Imaging, Hilversum, The Netherlands Arivis Vision4D v.3.5 Arrivis Arivis AG, Carl Zeiss Microscopy GmbH, Munich, Germany (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–19.e1–e8, May 4, 2026 e2 Article ..



    Similar Products

    ant gn 1 fugene promega  (InvivoGen)
    99
    InvivoGen ant gn 1 fugene promega
    Ant Gn 1 Fugene Promega, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ant+gn+1+fugene+promega/G418/pm42019505-253-152-150
    Average 99 stars, based on 1 article reviews
    ant gn 1 fugene promega - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results